| Label | Region | Length (bp) | Pi | Alignment reliability | MarkerSeek score | Primer available | Action |
|---|---|---|---|---|---|---|---|
| trnG (UCC)-trnR (UCU) | LSC | 342 | 0.0269 | 0.97 | 69.0 | yes | View details |
| petN-psbM | LSC | 728 | 0.0174 | 1.00 | 78.9 | yes | View details |
| trnT (UGU)-trnL (UAA) | LSC | 628 | 0.0193 | 1.00 | 70.9 | yes | View details |
| trnF (GAA)-ndhJ | LSC | 709 | 0.0143 | 0.98 | 64.5 | yes | View details |
| accD | LSC | 834 | 0.0148 | 0.95 | 62.7 | yes | View details |
| petA-psbJ | LSC | 937 | 0.0172 | 1.00 | 77.8 | yes | View details |
| rps12-psbB | LSC | 3011 | 0.0379 | 0.85 | 68.6 | yes | View details |
| ndhF-rpl32 | SSC | 974 | 0.0145 | 0.99 | 69.4 | yes | View details |
| accD-psaI | LSC | 614 | 0.0134 | 0.99 | 74.4 | yes | View details |
| ndhC-trnV (UAC) | LSC | 1184 | 0.0120 | 0.99 | 71.3 | yes | View details |
| rps16-trnQ (UUG) | LSC | 1408 | 0.0124 | 0.99 | 71.0 | yes | View details |
| trnC (GCA)-petN | LSC | 783 | 0.0125 | 0.94 | 69.4 | yes | View details |
| atpH-atpI | LSC | 1084 | 0.0077 | 1.00 | 68.4 | yes | View details |
| trnE (UUC)-trnT (GGU) | LSC | 796 | 0.0081 | 0.99 | 67.3 | yes | View details |
| trnS (GCU)-trnG (UCC) | LSC | 663 | 0.0077 | 1.00 | 67.1 | yes | View details |
| rpoB-trnC (GCA) | LSC | 1252 | 0.0076 | 0.99 | 66.4 | yes | View details |
| psbE-petL | LSC | 1312 | 0.0082 | 0.99 | 65.6 | yes | View details |
| atpB-rbcL | LSC | 763 | 0.0054 | 0.99 | 65.2 | yes | View details |
| Candidate markers include all hotspot labels marked in the diversity plot, listed in genomic order, plus the top 10 remaining regions by MarkerSeek score. Primer design is attempted for every listed region. Primer available: yes means at least one valid primer pair was found; no means no valid pair passed screening; NA means primer design was skipped. | |||||||
Species
45
Genome length
156–158 kb
Candidate markers
268
Primer pairs
90
Genome-wide nucleotide diversity
Candidate markers
8 hotspot labels from the diversity plot in genomic order, plus the top 10 remaining regions by MarkerSeek score (out of 268 candidates).
Primer pairs
Showing the top 30 of 90 primer pairs (ranked by primer score).
| Primer ID | Label | Forward | Reverse | Amplicon (bp) | Cross-species rate | Score |
|---|---|---|---|---|---|---|
| rps16-trnQ (UUG)_p1 | rps16-trnQ (UUG) | AACGGATCGTGTCCTTCAAG |
GAAATTGAAATGGGGCGTGG |
1455–1616 | 1.000 | 91.2 |
| rps16-trnQ (UUG)_p2 | rps16-trnQ (UUG) | AAGTCGCACGTTGCTTTCTA |
GAAATTGAAATGGGGCGTGG |
1438–1599 | 1.000 | 90.7 |
| rps16-trnQ (UUG)_p3 | rps16-trnQ (UUG) | CAACGGATCGTGTCCTTCAA |
GAAATTGAAATGGGGCGTGG |
1456–1617 | 1.000 | 90.1 |
| rps16-trnQ (UUG)_p4 | rps16-trnQ (UUG) | GGATCGTGTCCTTCAAGTCG |
GAAATTGAAATGGGGCGTGG |
1452–1613 | 1.000 | 88.9 |
| rps16-trnQ (UUG)_p5 | rps16-trnQ (UUG) | CGGATCGTGTCCTTCAAGTC |
GAAATTGAAATGGGGCGTGG |
1453–1614 | 1.000 | 88.8 |
| trnS (GCU)-trnG (UCC)_p1 | trnS (GCU)-trnG (UCC) | ATTAGCAATCCGCCGCTTTA |
TGAATTCAACCGAAAGACCCT |
619–793 | 0.978 | 76.1 |
| trnS (GCU)-trnG (UCC)_p2 | trnS (GCU)-trnG (UCC) | AGGAAACGGAAAGAGAGGGA |
TGAATTCAACCGAAAGACCCT |
673–847 | 0.978 | 75.8 |
| trnS (GCU)-trnG (UCC)_p3 | trnS (GCU)-trnG (UCC) | ACGGAAAGAGAGGGATTCGA |
TGAATTCAACCGAAAGACCCT |
668–842 | 0.978 | 74.8 |
| trnS (GCU)-trnG (UCC)_p4 | trnS (GCU)-trnG (UCC) | AGGAAACGGAAAGAGAGGGA |
GCACGAATCACACTTTTACCA |
630–804 | 1.000 | 73.5 |
| trnS (GCU)-trnG (UCC)_p5 | trnS (GCU)-trnG (UCC) | GCTTTAGTCCACTCAGCCAT |
TGAATTCAACCGAAAGACCCT |
605–779 | 0.978 | 73.2 |
| trnG (UCC)-trnR (UCU)_p1 | trnG (UCC)-trnR (UCU) | AGCCTTCCAAGCTAACGATG |
AGAAGACCTCTGTCCTATCCA |
422–486 | 1.000 | 75.3 |
| trnG (UCC)-trnR (UCU)_p2 | trnG (UCC)-trnR (UCU) | CCTAGCCTTCCAAGCTAACG |
AGAAGACCTCTGTCCTATCCA |
425–489 | 1.000 | 75.1 |
| trnG (UCC)-trnR (UCU)_p3 | trnG (UCC)-trnR (UCU) | AGCCTTCCAAGCTAACGATG |
AGGTTTAGAAGACCTCTGTCCT |
428–492 | 1.000 | 74.7 |
| trnG (UCC)-trnR (UCU)_p4 | trnG (UCC)-trnR (UCU) | CCTAGCCTTCCAAGCTAACG |
AGGTTTAGAAGACCTCTGTCCT |
431–495 | 1.000 | 74.5 |
| trnG (UCC)-trnR (UCU)_p5 | trnG (UCC)-trnR (UCU) | CCCTAGCCTTCCAAGCTAAC |
AGAAGACCTCTGTCCTATCCA |
426–490 | 1.000 | 72.9 |
| atpH-atpI_p1 | atpH-atpI | AACAGAAGCGGCAGAAATCA |
TTTTTGCAACTTTAGCCGCG |
1164–1248 | 1.000 | 82.6 |
| atpH-atpI_p2 | atpH-atpI | GCCAATCCAGCAGCAATAAC |
TTTTTGCAACTTTAGCCGCG |
1181–1265 | 1.000 | 81.6 |
| atpH-atpI_p3 | atpH-atpI | CAGCAGCAATAACAGAAGCG |
TTTTTGCAACTTTAGCCGCG |
1174–1258 | 0.978 | 81.0 |
| atpH-atpI_p4 | atpH-atpI | AACAGAAGCGGCAGAAATCA |
CCGCGGCTTATATAGGTGAA |
1149–1233 | 1.000 | 80.9 |
| atpH-atpI_p5 | atpH-atpI | AGTACCCTGACCAACTCCAG |
TTTTTGCAACTTTAGCCGCG |
1224–1308 | 1.000 | 80.3 |
| rpoB-trnC (GCA)_p1 | rpoB-trnC (GCA) | CGTCAAGCCCTGATCAATGA |
GTCTTTTGTTGATCAGGCGC |
1308–1438 | 1.000 | 89.2 |
| rpoB-trnC (GCA)_p2 | rpoB-trnC (GCA) | CGTCAAGCCCTGATCAATGA |
AAAAGGATTTGCAGTCCCCC |
1267–1397 | 1.000 | 86.7 |
| rpoB-trnC (GCA)_p3 | rpoB-trnC (GCA) | AAAGTTCTTCCGTCAAGCCC |
GTCTTTTGTTGATCAGGCGC |
1318–1448 | 1.000 | 86.2 |
| rpoB-trnC (GCA)_p4 | rpoB-trnC (GCA) | TTCTTTTTCATCCCGGAGCA |
GTCTTTTGTTGATCAGGCGC |
1233–1363 | 1.000 | 85.0 |
| rpoB-trnC (GCA)_p5 | rpoB-trnC (GCA) | AAAGTTCTTCCGTCAAGCCC |
AAAAGGATTTGCAGTCCCCC |
1277–1407 | 1.000 | 83.7 |
| trnC (GCA)-petN_p1 | trnC (GCA)-petN | GGGGGACTGCAAATCCTTTT |
AGCCCAAGCGAGACTTACTA |
817–867 | 1.000 | 87.9 |
| trnC (GCA)-petN_p2 | trnC (GCA)-petN | GGGGGACTGCAAATCCTTTT |
AGAGTCCACTTCTTCCCCAT |
878–928 | 1.000 | 86.3 |
| trnC (GCA)-petN_p3 | trnC (GCA)-petN | TATCCATTTGGCGACATGGC |
AGCCCAAGCGAGACTTACTA |
850–900 | 1.000 | 85.3 |
| trnC (GCA)-petN_p4 | trnC (GCA)-petN | TATCCATTTGGCGACATGGC |
AGAGTCCACTTCTTCCCCAT |
911–961 | 1.000 | 83.7 |
| trnC (GCA)-petN_p5 | trnC (GCA)-petN | AGTTCAAATCTGGGTGGCG |
AGCCCAAGCGAGACTTACTA |
792–842 | 1.000 | 82.4 |
Result downloads
Reference species (45)
One GenBank record per species. Use the NCBI button to open the Nucleotide entry for the listed accession.
| Species | Accession | Length (bp) | Link |
|---|---|---|---|
| Actinidia arguta var. hypoleuca | OM949906.1 | 157500 | View on NCBI ↗ |
| Actinidia callosa var. discolor | OM949888.1 | 156330 | View on NCBI ↗ |
| Actinidia chengkouensis | OM949912.1 | 156893 | View on NCBI ↗ |
| Actinidia chinensis | NC_026690.1 | 156346 | View on NCBI ↗ |
| Actinidia chrysantha | OM949890.1 | 156828 | View on NCBI ↗ |
| Actinidia cylindrica | OM949905.1 | 156440 | View on NCBI ↗ |
| Actinidia farinosa | OM949917.1 | 156413 | View on NCBI ↗ |
| Actinidia fasciculoides | OM949913.1 | 155755 | View on NCBI ↗ |
| Actinidia fortunatii | OM949932.1 | 155789 | View on NCBI ↗ |
| Actinidia fulvicoma | NC_051888.1 | 157339 | View on NCBI ↗ |
| Actinidia glaucocallosa | OM949892.1 | 157070 | View on NCBI ↗ |
| Actinidia glaucophylla | OM949889.1 | 156488 | View on NCBI ↗ |
| Actinidia grandiflora | OM949914.1 | 156389 | View on NCBI ↗ |
| Actinidia henryi | OM949904.1 | 156319 | View on NCBI ↗ |
| Actinidia holotricha | OM949927.1 | 156508 | View on NCBI ↗ |
| Actinidia hubeiensis | OM949937.1 | 156283 | View on NCBI ↗ |
| Actinidia indochinensis | OM949936.1 | 156830 | View on NCBI ↗ |
| Actinidia laevissima | OM949921.1 | 155992 | View on NCBI ↗ |
| Actinidia liangguangensis | OM949922.1 | 156084 | View on NCBI ↗ |
| Actinidia linguiensis | OM949924.1 | 156170 | View on NCBI ↗ |
| Actinidia longicarpa | OM949907.1 | 157243 | View on NCBI ↗ |
| Actinidia macrosperma | NC_051887.1 | 156231 | View on NCBI ↗ |
| Actinidia melanandra | OM949901.1 | 157805 | View on NCBI ↗ |
| Actinidia melliana | OM949926.1 | 156651 | View on NCBI ↗ |
| Actinidia obovata | OM949915.1 | 156922 | View on NCBI ↗ |
| Actinidia persicina | OM949916.1 | 156424 | View on NCBI ↗ |
| Actinidia pilosula | OM949918.1 | 157281 | View on NCBI ↗ |
| Actinidia polygama | NC_031186.1 | 156583 | View on NCBI ↗ |
| Actinidia rongshuiensis | OM949928.1 | 157173 | View on NCBI ↗ |
| Actinidia rubricaulis var. coriacea | OM949903.1 | 156741 | View on NCBI ↗ |
| Actinidia rubus | NC_053769.1 | 156573 | View on NCBI ↗ |
| Actinidia rudis | OM949911.1 | 155612 | View on NCBI ↗ |
| Actinidia rufa | NC_039973.1 | 156543 | View on NCBI ↗ |
| Actinidia rufotricha | OM949919.1 | 155538 | View on NCBI ↗ |
| Actinidia sabiifolia | OM949895.1 | 157275 | View on NCBI ↗ |
| Actinidia setosa | NC_051881.1 | 156728 | View on NCBI ↗ |
| Actinidia sorbifolia | OM949885.1 | 156245 | View on NCBI ↗ |
| Actinidia styracifolia | OM949908.1 | 157022 | View on NCBI ↗ |
| Actinidia suberifolia | OM949909.1 | 156922 | View on NCBI ↗ |
| Actinidia trichogyna | PX754132.1 | 156507 | View on NCBI ↗ |
| Actinidia umbelloides | OM949929.1 | 155813 | View on NCBI ↗ |
| Actinidia valvata | NC_050357.1 | 156548 | View on NCBI ↗ |
| Actinidia venosa | NC_069068.1 | 156544 | View on NCBI ↗ |
| Actinidia vitifolia | OM949884.1 | 156230 | View on NCBI ↗ |
| Actinidia zhejiangensis | OM949935.1 | 156967 | View on NCBI ↗ |