| Label | Region | Length (bp) | Pi | Alignment reliability | MarkerSeek score | Primer available | Action |
|---|---|---|---|---|---|---|---|
| rps4-rps16 | LSC | 563 | 0.0137 | 1.00 | 73.0 | yes | View details |
| atpB-rbcL | LSC | 863 | 0.0097 | 1.00 | 64.2 | yes | View details |
| ycf1 | IRb | 1710 | 0.0044 | 1.00 | 41.6 | no | View details |
| ndhF | SSC | 2235 | 0.0087 | 1.00 | 56.2 | yes | View details |
| ndhF-rpl32 | SSC | 1041 | 0.0228 | 0.99 | 67.9 | yes | View details |
| rpl32-trnL-UAG | SSC | 784 | 0.0180 | 0.98 | 70.3 | yes | View details |
| ndhD | SSC | 1479 | 0.0039 | 1.00 | 44.8 | yes | View details |
| ndhE-ndhG | SSC | 277 | 0.0289 | 0.99 | 75.4 | yes | View details |
| ndhG | SSC | 534 | 0.0020 | 1.00 | 33.2 | yes | View details |
| ndhG-ndhI | SSC | 492 | 0.0162 | 0.97 | 71.6 | yes | View details |
| ycf1 | SSC | 5643 | 0.0074 | 1.00 | 69.9 | yes | View details |
| infA-rps4 | IRa | 23 | 0.0496 | 1.00 | 78.3 | no | View details |
| rps16-trnK-UUU | LSC | 649 | 0.0116 | 0.99 | 72.7 | yes | View details |
| psbE-petL | LSC | 1380 | 0.0089 | 1.00 | 72.1 | yes | View details |
| atpH-atpI | LSC | 1104 | 0.0055 | 1.00 | 68.7 | yes | View details |
| ycf4-cemA | LSC | 599 | 0.0103 | 1.00 | 67.1 | yes | View details |
| psbI-trnS-GCU | LSC | 86 | 0.0301 | 1.00 | 67.0 | yes | View details |
| trnS-GGA-trnV-UAC | LSC | 1112 | 0.0115 | 1.00 | 67.0 | yes | View details |
| petB | LSC | 1431 | 0.0052 | 1.00 | 66.9 | yes | View details |
| Candidate markers include all hotspot labels marked in the diversity plot, listed in genomic order, plus the top 10 remaining regions by MarkerSeek score. Primer design is attempted for every listed region. Primer available: yes means at least one valid primer pair was found; no means no valid pair passed screening; NA means primer design was skipped. | |||||||
Species
160
Genome length
159–160 kb
Candidate markers
278
Primer pairs
85
Genome-wide nucleotide diversity
Candidate markers
11 hotspot labels from the diversity plot in genomic order, plus the top 8 remaining regions by MarkerSeek score (out of 278 candidates).
Primer pairs
Showing the top 30 of 85 primer pairs (ranked by primer score).
| Primer ID | Label | Forward | Reverse | Amplicon (bp) | Cross-species rate | Score |
|---|---|---|---|---|---|---|
| rps4-rps16_p1 | rps4-rps16 | GTAAGTGGGTCGGTTTGGAA |
ATTCCTTCAAGTCGCACGTT |
661–710 | 1.000 | 89.0 |
| rps4-rps16_p2 | rps4-rps16 | GTAAGTGGGTCGGTTTGGAA |
AAGTCGCACGTTGCTTTCTA |
653–702 | 1.000 | 88.8 |
| rps4-rps16_p3 | rps4-rps16 | AAGTGGGTCGGTTTGGAAAT |
ATTCCTTCAAGTCGCACGTT |
659–708 | 1.000 | 88.0 |
| rps4-rps16_p4 | rps4-rps16 | AAGTGGGTCGGTTTGGAAAT |
AAGTCGCACGTTGCTTTCTA |
651–700 | 1.000 | 87.9 |
| rps4-rps16_p5 | rps4-rps16 | AGTAAGTGGGTCGGTTTGGA |
ATTCCTTCAAGTCGCACGTT |
662–711 | 1.000 | 86.4 |
| rps16-trnK-UUU_p1 | rps16-trnK-UUU | GCTCAACCTACGGAAACTGT |
TCTACCAACGGTATGGACGA |
783–845 | 1.000 | 89.7 |
| rps16-trnK-UUU_p2 | rps16-trnK-UUU | GCTCAACCTACGGAAACTGT |
AAAGCCGAGTACTCTACCGT |
718–780 | 1.000 | 89.3 |
| rps16-trnK-UUU_p3 | rps16-trnK-UUU | GCTCAACCTACGGAAACTGT |
AAGCCGAGTACTCTACCGTT |
717–779 | 1.000 | 89.3 |
| rps16-trnK-UUU_p4 | rps16-trnK-UUU | CCTTGAAAAAGGCGCTCAAC |
TCTACCAACGGTATGGACGA |
796–858 | 1.000 | 89.1 |
| rps16-trnK-UUU_p5 | rps16-trnK-UUU | CTTGAAAAAGGCGCTCAACC |
TCTACCAACGGTATGGACGA |
795–857 | 1.000 | 89.1 |
| psbI-trnS-GCU_p1 | psbI-trnS-GCU | CGTAATCCTGGACGTGAAGA |
TGGACTAAAGCGTCGGATTG |
174–184 | 1.000 | 81.7 |
| psbI-trnS-GCU_p2 | psbI-trnS-GCU | CGTAATCCTGGACGTGAAGA |
GTGGACTAAAGCGTCGGATT |
175–185 | 1.000 | 81.7 |
| psbI-trnS-GCU_p3 | psbI-trnS-GCU | CGTAATCCTGGACGTGAAGA |
ATTGGGAGAGATGGCTGAGT |
193–203 | 1.000 | 80.8 |
| psbI-trnS-GCU_p4 | psbI-trnS-GCU | CGTAATCCTGGACGTGAAGAA |
TGGACTAAAGCGTCGGATTG |
174–184 | 1.000 | 79.4 |
| psbI-trnS-GCU_p5 | psbI-trnS-GCU | CGTAATCCTGGACGTGAAGAA |
GTGGACTAAAGCGTCGGATT |
175–185 | 1.000 | 79.4 |
| atpH-atpI_p1 | atpH-atpI | TCCAGGTCCAATAGAAGCCA |
ATAGGGGAATCCATGGAGGG |
902–1275 | 1.000 | 91.2 |
| atpH-atpI_p2 | atpH-atpI | AGCCAATCCAGCAGCAATAA |
ATAGGGGAATCCATGGAGGG |
875–1248 | 1.000 | 90.3 |
| atpH-atpI_p3 | atpH-atpI | GATACCTTCTACGGCTTGGC |
ATAGGGGAATCCATGGAGGG |
944–1317 | 1.000 | 90.2 |
| atpH-atpI_p4 | atpH-atpI | CGATACCTTCTACGGCTTGG |
ATAGGGGAATCCATGGAGGG |
945–1318 | 1.000 | 90.2 |
| atpH-atpI_p5 | atpH-atpI | AACGGAAGCAGCAGAAATCA |
ATAGGGGAATCCATGGAGGG |
857–1193 | 0.981 | 89.8 |
| trnS-GGA-trnV-UAC_p1 | trnS-GGA-trnV-UAC | AGGCTTTTGTTTACCGAGGG |
AGAAGGTCTACGGTTCGAGT |
964–1214 | 1.000 | 89.7 |
| trnS-GGA-trnV-UAC_p2 | trnS-GGA-trnV-UAC | TTTAGGAGAGATGGCCGAGT |
AGAAGGTCTACGGTTCGAGT |
1015–1265 | 1.000 | 89.1 |
| trnS-GGA-trnV-UAC_p3 | trnS-GGA-trnV-UAC | GGCTTTTGTTTACCGAGGGT |
AGAAGGTCTACGGTTCGAGT |
963–1213 | 1.000 | 87.3 |
| trnS-GGA-trnV-UAC_p4 | trnS-GGA-trnV-UAC | AGGCTTTTGTTTACCGAGGG |
GAAGGTCTACGGTTCGAGTC |
963–1213 | 1.000 | 86.9 |
| trnS-GGA-trnV-UAC_p5 | trnS-GGA-trnV-UAC | TCTTTAGGAGAGATGGCCGA |
AGAAGGTCTACGGTTCGAGT |
1017–1267 | 1.000 | 86.8 |
| atpB-rbcL_p1 | atpB-rbcL | CATCCAGTACCGGACCAATG |
AGCCAACACTCGCTTTAGTC |
953–1037 | 0.975 | 89.0 |
| atpB-rbcL_p2 | atpB-rbcL | CATCCAGTACCGGACCAATG |
GCCAACACTCGCTTTAGTCT |
952–1036 | 0.975 | 89.0 |
| atpB-rbcL_p3 | atpB-rbcL | CATCCAGTACCGGACCAATG |
TGAAGCCAACACTCGCTTTA |
956–1040 | 0.975 | 88.6 |
| atpB-rbcL_p4 | atpB-rbcL | CATCCAGTACCGGACCAATG |
AAGCCAACACTCGCTTTAGT |
954–1038 | 0.975 | 88.6 |
| atpB-rbcL_p5 | atpB-rbcL | TTCTTCAAGAGCGGAAACCC |
GCCAACACTCGCTTTAGTCT |
906–990 | 0.975 | 88.5 |
Result downloads
Reference species (160)
One GenBank record per species. Use the NCBI button to open the Nucleotide entry for the listed accession.
| Species | Accession | Length (bp) | Link |
|---|---|---|---|
| Clematis acerifolia | NC_039844.1 | 159552 | View on NCBI ↗ |
| Clematis acerifolia var. elobata | NC_065272.1 | 159690 | View on NCBI ↗ |
| Clematis aethusifolia | OR801209.1 | 159682 | View on NCBI ↗ |
| Clematis akebioides | OR801210.1 | 159600 | View on NCBI ↗ |
| Clematis akoensis | PQ834329.1 | 159716 | View on NCBI ↗ |
| Clematis alpina | PP328796.1 | 159577 | View on NCBI ↗ |
| Clematis alpina subsp. ochotensis | MT876505.1 | 159631 | View on NCBI ↗ |
| Clematis alpina subsp. sibirica | PQ874705.1 | 159701 | View on NCBI ↗ |
| Clematis alternata | NC_039577.1 | 159476 | View on NCBI ↗ |
| Clematis apiifolia | NC_081049.1 | 159682 | View on NCBI ↗ |
| Clematis apiifolia var. argentilucida | PQ636498.1 | 159637 | View on NCBI ↗ |
| Clematis aristata | PX223807.1 | 159524 | View on NCBI ↗ |
| Clematis armandi | NC_069848.1 | 159353 | View on NCBI ↗ |
| Clematis armandi var. hefengensis | PQ834331.1 | 159317 | View on NCBI ↗ |
| Clematis aureolata | NC_069849.1 | 159548 | View on NCBI ↗ |
| Clematis barbellata var. obtusa | PX223808.1 | 159597 | View on NCBI ↗ |
| Clematis brachiata | NC_065250.1 | 159678 | View on NCBI ↗ |
| Clematis brachyura | NC_042793.1 | 159532 | View on NCBI ↗ |
| Clematis brevicaudata | NC_039579.1 | 159583 | View on NCBI ↗ |
| Clematis brevipes | PQ834333.1 | 159670 | View on NCBI ↗ |
| Clematis buchananiana | PQ834334.1 | 159737 | View on NCBI ↗ |
| Clematis cadmia | NC_065251.1 | 159714 | View on NCBI ↗ |
| Clematis calcicola | NC_066977.1 | 159658 | View on NCBI ↗ |
| Clematis campestris | NC_065264.1 | 159671 | View on NCBI ↗ |
| Clematis canescens | NC_065265.1 | 159752 | View on NCBI ↗ |
| Clematis chinensis | NC_066718.1 | 159497 | View on NCBI ↗ |
| Clematis chingii | PX223809.1 | 159651 | View on NCBI ↗ |
| Clematis chrysocoma | NC_065266.1 | 159584 | View on NCBI ↗ |
| Clematis cirrhosa | PQ834338.1 | 159480 | View on NCBI ↗ |
| Clematis clarkeana | PQ834339.1 | 159709 | View on NCBI ↗ |
| Clematis connata | NC_065267.1 | 159768 | View on NCBI ↗ |
| Clematis connata var. confusa | PQ834340.1 | 159720 | View on NCBI ↗ |
| Clematis courtoisii | PQ834343.1 | 159570 | View on NCBI ↗ |
| Clematis crassifolia | NC_065268.1 | 159312 | View on NCBI ↗ |
| Clematis crassipes | PX223810.1 | 159675 | View on NCBI ↗ |
| Clematis crispa | NC_065269.1 | 159304 | View on NCBI ↗ |
| Clematis danxiacola | PQ246280.1 | 159506 | View on NCBI ↗ |
| Clematis delavayi | NC_065270.1 | 159659 | View on NCBI ↗ |
| Clematis dolichopoda | PQ874706.1 | 159670 | View on NCBI ↗ |
| Clematis drummondii | NC_065271.1 | 159729 | View on NCBI ↗ |
| Clematis fasciculiflora | PQ874707.1 | 159665 | View on NCBI ↗ |
| Clematis finetiana | PQ874708.1 | 159505 | View on NCBI ↗ |
| Clematis flammula | PQ874709.1 | 159594 | View on NCBI ↗ |
| Clematis florida | NC_058885.1 | 159606 | View on NCBI ↗ |
| Clematis fruticosa | NC_065273.1 | 159796 | View on NCBI ↗ |
| Clematis fusca | NC_060524.1 | 159624 | View on NCBI ↗ |
| Clematis fusca var. coreana | KM652489.1 | 159609 | View on NCBI ↗ |
| Clematis glabrifolia | PQ874712.1 | 159557 | View on NCBI ↗ |
| Clematis glaucophylla | NC_065274.1 | 159302 | View on NCBI ↗ |
| Clematis gouriana | NC_081050.1 | 159681 | View on NCBI ↗ |
| Clematis gracilifolia | PQ874713.1 | 159717 | View on NCBI ↗ |
| Clematis grandidentata | NC_081051.1 | 159634 | View on NCBI ↗ |
| Clematis grata | PQ874714.1 | 159599 | View on NCBI ↗ |
| Clematis gratopsis | NC_081052.1 | 159643 | View on NCBI ↗ |
| Clematis grewiiflora | PQ874715.1 | 159816 | View on NCBI ↗ |
| Clematis guniuensis | NC_050373.1 | 159682 | View on NCBI ↗ |
| Clematis hancockiana | PQ874717.1 | 159592 | View on NCBI ↗ |
| Clematis henryi | NC_070190.1 | 159707 | View on NCBI ↗ |
| Clematis henryi var. ternata | MW380948.1 | 159675 | View on NCBI ↗ |
| Clematis heracleifolia | NC_039845.1 | 159565 | View on NCBI ↗ |
| Clematis hexapetala | NC_065276.1 | 159534 | View on NCBI ↗ |
| Clematis hexapetala var. tchefouensis | PQ874719.1 | 159535 | View on NCBI ↗ |
| Clematis hirsuta | PQ874720.1 | 159616 | View on NCBI ↗ |
| Clematis hirsutissima | PQ874723.1 | 159613 | View on NCBI ↗ |
| Clematis hirsutissima var. scottii | PQ874722.1 | 159321 | View on NCBI ↗ |
| Clematis huchouensis | NC_065277.1 | 159590 | View on NCBI ↗ |
| Clematis insidiosa | PQ874724.1 | 159777 | View on NCBI ↗ |
| Clematis integrifolia | NC_081053.1 | 159630 | View on NCBI ↗ |
| Clematis intricata | NC_065278.1 | 159593 | View on NCBI ↗ |
| Clematis japonica | PQ874725.1 | 159758 | View on NCBI ↗ |
| Clematis javana | PQ874726.1 | 159483 | View on NCBI ↗ |
| Clematis jingdungensis | PQ874727.1 | 159699 | View on NCBI ↗ |
| Clematis kirilowii | PQ874728.1 | 159509 | View on NCBI ↗ |
| Clematis kockiana | PQ874729.1 | 159714 | View on NCBI ↗ |
| Clematis koreana | PQ874730.1 | 159622 | View on NCBI ↗ |
| Clematis kweichowensis | PQ874731.1 | 159746 | View on NCBI ↗ |
| Clematis lancifolia | NC_065279.1 | 159447 | View on NCBI ↗ |
| Clematis lasiandra | NC_065286.1 | 159688 | View on NCBI ↗ |
| Clematis lasiantha | NC_065280.1 | 159334 | View on NCBI ↗ |
| Clematis leschenaultiana | NC_065281.1 | 159622 | View on NCBI ↗ |
| Clematis liboensis | PX223811.1 | 159670 | View on NCBI ↗ |
| Clematis ligusticifolia | NC_065282.1 | 159600 | View on NCBI ↗ |
| Clematis linearifolia | PQ874732.1 | 159581 | View on NCBI ↗ |
| Clematis loureiroana | NC_039690.1 | 159624 | View on NCBI ↗ |
| Clematis macropetala | NC_041477.1 | 159647 | View on NCBI ↗ |
| Clematis mae | PQ874733.1 | 159546 | View on NCBI ↗ |
| Clematis mandshurica | NC_079957.1 | 159564 | View on NCBI ↗ |
| Clematis mauritiana | PQ874734.1 | 159846 | View on NCBI ↗ |
| Clematis metouensis | PQ874736.1 | 159641 | View on NCBI ↗ |
| Clematis meyeniana | PQ874737.1 | 159601 | View on NCBI ↗ |
| Clematis montana | NC_057507.1 | 159523 | View on NCBI ↗ |
| Clematis montana var. glabrescens | PQ874738.1 | 159623 | View on NCBI ↗ |
| Clematis nannophylla | NC_065283.1 | 159814 | View on NCBI ↗ |
| Clematis napaulensis | PQ874739.1 | 159733 | View on NCBI ↗ |
| Clematis obscura | PQ874740.1 | 159639 | View on NCBI ↗ |
| Clematis occidentalis | PQ874741.1 | 159536 | View on NCBI ↗ |
| Clematis orientalis | NC_071961.1 | 159543 | View on NCBI ↗ |
| Clematis otophora | NC_069850.1 | 159534 | View on NCBI ↗ |
| Clematis parviloba | NC_081054.1 | 159664 | View on NCBI ↗ |
| Clematis pashanensis | PQ874743.1 | 159520 | View on NCBI ↗ |
| Clematis patens | NC_063559.1 | 159603 | View on NCBI ↗ |
| Clematis patens subsp. tientaiensis | NC_085220.1 | 159644 | View on NCBI ↗ |
| Clematis peterae | NC_081055.1 | 159676 | View on NCBI ↗ |
| Clematis petriei | NC_065284.1 | 159425 | View on NCBI ↗ |
| Clematis pierotii | PQ874744.1 | 159639 | View on NCBI ↗ |
| Clematis pinchuanensis | PQ874745.1 | 159744 | View on NCBI ↗ |
| Clematis pinnata | NC_065248.1 | 159652 | View on NCBI ↗ |
| Clematis pitcheri | PQ874746.1 | 159295 | View on NCBI ↗ |
| Clematis pogonandra | PQ874747.1 | 159660 | View on NCBI ↗ |
| Clematis potaninii | NC_058760.1 | 159691 | View on NCBI ↗ |
| Clematis pseudoconnata | PQ834341.1 | 159711 | View on NCBI ↗ |
| Clematis pseudootophora | PQ874748.1 | 159553 | View on NCBI ↗ |
| Clematis pseudopogonandra | PQ874749.1 | 159636 | View on NCBI ↗ |
| Clematis psilandra | NC_081056.1 | 159622 | View on NCBI ↗ |
| Clematis pubescens | NC_065285.1 | 159391 | View on NCBI ↗ |
| Clematis qingchengshanica | PQ874750.1 | 159686 | View on NCBI ↗ |
| Clematis quinquefoliolata | NC_065287.1 | 159724 | View on NCBI ↗ |
| Clematis ranunculoides | NC_081994.1 | 159741 | View on NCBI ↗ |
| Clematis recta | PP328797.1 | 159596 | View on NCBI ↗ |
| Clematis rehderiana | NC_069851.1 | 159582 | View on NCBI ↗ |
| Clematis repens | NC_039578.1 | 159507 | View on NCBI ↗ |
| Clematis reticulata | NC_065288.1 | 159284 | View on NCBI ↗ |
| Clematis rubifolia | PQ874753.1 | 159624 | View on NCBI ↗ |
| Clematis rutoides | NC_065289.1 | 159678 | View on NCBI ↗ |
| Clematis serratifolia | NC_060523.1 | 159648 | View on NCBI ↗ |
| Clematis shenlungchiaensis | PQ874755.1 | 159657 | View on NCBI ↗ |
| Clematis shensiensis | PQ874756.1 | 159553 | View on NCBI ↗ |
| Clematis siamensis | PQ874757.1 | 159735 | View on NCBI ↗ |
| Clematis simensis | PQ874758.1 | 159633 | View on NCBI ↗ |
| Clematis songarica | PP998037.1 | 159584 | View on NCBI ↗ |
| Clematis songorica | NC_065290.1 | 159822 | View on NCBI ↗ |
| Clematis speciosa | NC_081062.1 | 159753 | View on NCBI ↗ |
| Clematis stans | NC_081057.1 | 159671 | View on NCBI ↗ |
| Clematis stans var. austrojaponensis | ON411443.1 | 159775 | View on NCBI ↗ |
| Clematis subumbellata | NC_081058.1 | 159687 | View on NCBI ↗ |
| Clematis tamurae | PQ874760.1 | 159623 | View on NCBI ↗ |
| Clematis tangutica | NC_080984.1 | 159584 | View on NCBI ↗ |
| Clematis tashiroi | PQ874761.1 | 159740 | View on NCBI ↗ |
| Clematis terniflora | NC_028000.1 | 159528 | View on NCBI ↗ |
| Clematis texensis | PQ874763.1 | 159294 | View on NCBI ↗ |
| Clematis tibetana | NC_069852.1 | 159540 | View on NCBI ↗ |
| Clematis tomentella | NC_065291.1 | 159818 | View on NCBI ↗ |
| Clematis tosaensis | PQ874765.1 | 159783 | View on NCBI ↗ |
| Clematis tsaii | PQ874766.1 | 159682 | View on NCBI ↗ |
| Clematis tsugetorum | NC_081059.1 | 159611 | View on NCBI ↗ |
| Clematis tubulosa | NC_065249.1 | 159653 | View on NCBI ↗ |
| Clematis tubulosa var. ichangensis | ON411454.1 | 159654 | View on NCBI ↗ |
| Clematis uncinata | NC_039846.1 | 159524 | View on NCBI ↗ |
| Clematis urophylla | NC_065292.1 | 159696 | View on NCBI ↗ |
| Clematis urticifolia | NC_081060.1 | 159720 | View on NCBI ↗ |
| Clematis villosa | PV600631.1 | 159600 | View on NCBI ↗ |
| Clematis virginiana | NC_065293.1 | 159561 | View on NCBI ↗ |
| Clematis viridis | NC_065294.1 | 159847 | View on NCBI ↗ |
| Clematis vitalba | NC_081061.1 | 159710 | View on NCBI ↗ |
| Clematis viticella | PQ874767.1 | 159646 | View on NCBI ↗ |
| Clematis williamsii | NC_065295.1 | 159645 | View on NCBI ↗ |
| Clematis xiangguiensis | NC_065296.1 | 159575 | View on NCBI ↗ |
| Clematis yui | PQ874768.1 | 159301 | View on NCBI ↗ |
| Clematis yunnanensis | PQ874769.1 | 159699 | View on NCBI ↗ |
| Clematis zandaensis | PQ874770.1 | 159543 | View on NCBI ↗ |