| Label | Region | Length (bp) | Pi | Alignment reliability | MarkerSeek score | Primer available | Action |
|---|---|---|---|---|---|---|---|
| petD | LSC | 1227 | 0.0102 | 1.00 | 62.8 | yes | View details |
| ycf1 | IRb | 792 | 0.0031 | 1.00 | 40.6 | no | View details |
| ndhF | SSC | 2232 | 0.0069 | 1.00 | 51.1 | yes | View details |
| rpl32-trnL-UAG | SSC | 877 | 0.0178 | 0.99 | 68.2 | yes | View details |
| ycf1 | SSC | 5379 | 0.0102 | 1.00 | 57.5 | yes | View details |
| ndhC-trnV-UAC | LSC | 1183 | 0.0080 | 0.99 | 72.7 | yes | View details |
| petN-psbM | LSC | 984 | 0.0088 | 1.00 | 68.7 | yes | View details |
| trnF-GAA-ndhJ | LSC | 639 | 0.0072 | 1.00 | 67.5 | yes | View details |
| psbE-petL | LSC | 922 | 0.0053 | 1.00 | 66.8 | yes | View details |
| rps2-rpoC2 | LSC | 229 | 0.0212 | 0.94 | 66.3 | yes | View details |
| atpB-rbcL | LSC | 779 | 0.0051 | 0.99 | 65.3 | yes | View details |
| atpH-atpI | LSC | 1025 | 0.0067 | 1.00 | 64.7 | yes | View details |
| ycf3-trnS-GGA | LSC | 854 | 0.0046 | 1.00 | 64.3 | yes | View details |
| trnC-GCA-petN | LSC | 842 | 0.0085 | 0.99 | 64.2 | yes | View details |
| trnK-UUU-rps16 | LSC | 989 | 0.0112 | 0.98 | 63.7 | yes | View details |
| Candidate markers include all hotspot labels marked in the diversity plot, listed in genomic order, plus the top 10 remaining regions by MarkerSeek score. Primer design is attempted for every listed region. Primer available: yes means at least one valid primer pair was found; no means no valid pair passed screening; NA means primer design was skipped. | |||||||
Species
192
Genome length
142–156 kb
Candidate markers
264
Primer pairs
75
Genome-wide nucleotide diversity
Candidate markers
5 hotspot labels from the diversity plot in genomic order, plus the top 10 remaining regions by MarkerSeek score (out of 264 candidates).
Primer pairs
Showing the top 30 of 75 primer pairs (ranked by primer score).
| Primer ID | Label | Forward | Reverse | Amplicon (bp) | Cross-species rate | Score |
|---|---|---|---|---|---|---|
| trnK-UUU-rps16_p1 | trnK-UUU-rps16 | AAAGCCGAGTACTCTACCGT |
GTGCTCAACCCACAGGAAC |
97–1997 | 0.984 | 76.7 |
| trnK-UUU-rps16_p2 | trnK-UUU-rps16 | AAGCCGAGTACTCTACCGTT |
GTGCTCAACCCACAGGAAC |
97–1997 | 0.984 | 76.7 |
| trnK-UUU-rps16_p3 | trnK-UUU-rps16 | TCTAGCCGCACTTAAAAGCC |
GTGCTCAACCCACAGGAAC |
896–1996 | 0.995 | 76.3 |
| trnK-UUU-rps16_p4 | trnK-UUU-rps16 | AAAGCCGAGTACTCTACCGT |
TGCTCAACCCACAGGAACT |
100–1996 | 0.984 | 75.9 |
| trnK-UUU-rps16_p5 | trnK-UUU-rps16 | AAGCCGAGTACTCTACCGTT |
TGCTCAACCCACAGGAACT |
100–1996 | 0.984 | 75.9 |
| atpH-atpI_p1 | atpH-atpI | TACCCTCTACAGCTTGACCC |
TTTTTGCAACTTTAGCCGCG |
1002–1306 | 1.000 | 86.8 |
| atpH-atpI_p2 | atpH-atpI | AACGGAAGCAGCAGAAATCA |
TTTTTGCAACTTTAGCCGCG |
917–1221 | 0.995 | 86.8 |
| atpH-atpI_p3 | atpH-atpI | AGCCAATCCAGCAGCAATAA |
TTTTTGCAACTTTAGCCGCG |
935–1239 | 0.995 | 86.5 |
| atpH-atpI_p4 | atpH-atpI | GCCAATCCAGCAGCAATAAC |
TTTTTGCAACTTTAGCCGCG |
934–1238 | 0.995 | 85.9 |
| atpH-atpI_p5 | atpH-atpI | TCCAGCAGCAATAACGGAAG |
TTTTTGCAACTTTAGCCGCG |
929–1233 | 1.000 | 85.8 |
| rps2-rpoC2_p1 | rps2-rpoC2 | TGCAGAGATATAGGGTGCCA |
TCGATGATACATCAGAACAATCA |
106–2120 | 0.958 | 50.3 |
| rps2-rpoC2_p2 | rps2-rpoC2 | TGCAGAGATATAGGGTGCCA |
TTCGATGATACATCAGAACAATCA |
107–2121 | 0.958 | 50.3 |
| rps2-rpoC2_p3 | rps2-rpoC2 | TGCAGAGATATAGGGTGCCA |
CGATGATACATCAGAACAATCA |
103–768 | 0.958 | 50.3 |
| rps2-rpoC2_p4 | rps2-rpoC2 | CCTCCAGCATCTCTTCCAAG |
TCGATGATACATCAGAACAATCA |
80–2122 | 0.948 | 49.9 |
| rps2-rpoC2_p5 | rps2-rpoC2 | AAATGAACTCCTGCCTCCAG |
TCGATGATACATCAGAACAATCA |
80–2119 | 0.906 | 48.3 |
| trnC-GCA-petN_p1 | trnC-GCA-petN | TTTCCCCAGTTCAAATCCGG |
ACTTCTTCCCCACACTACGA |
80–993 | 1.000 | 91.3 |
| trnC-GCA-petN_p2 | trnC-GCA-petN | TTTCCCCAGTTCAAATCCGG |
TTCTTCCCCACACTACGAGT |
80–991 | 1.000 | 91.3 |
| trnC-GCA-petN_p3 | trnC-GCA-petN | TTTCCCCAGTTCAAATCCGG |
CACTTCTTCCCCACACTACG |
80–994 | 1.000 | 90.7 |
| trnC-GCA-petN_p4 | trnC-GCA-petN | TTTCCCCAGTTCAAATCCGG |
TCTAGAGCCCACTTCTTCCC |
80–1003 | 0.995 | 90.1 |
| trnC-GCA-petN_p5 | trnC-GCA-petN | TTTCCCCAGTTCAAATCCGG |
AGCCCAAGCGAGACTTACTA |
80–939 | 0.995 | 89.9 |
| petN-psbM_p1 | petN-psbM | TCGTAGTGTGGGGAAGAAGT |
TGCTACTGCGCTATTCATTCT |
80–1123 | 1.000 | 80.3 |
| petN-psbM_p2 | petN-psbM | ACTCGTAGTGTGGGGAAGAA |
TGCTACTGCGCTATTCATTCT |
80–1125 | 0.995 | 80.1 |
| petN-psbM_p3 | petN-psbM | CGTAGTGTGGGGAAGAAGTG |
TGCTACTGCGCTATTCATTCT |
80–1122 | 1.000 | 79.7 |
| petN-psbM_p4 | petN-psbM | TAGTAAGTCTCGCTTGGGCT |
TGCTACTGCGCTATTCATTCT |
80–1177 | 1.000 | 79.1 |
| petN-psbM_p5 | petN-psbM | GTAGTGTGGGGAAGAAGTGG |
TGCTACTGCGCTATTCATTCT |
80–1121 | 1.000 | 76.5 |
| ycf3-trnS-GGA_p1 | ycf3-trnS-GGA | TGCCTCCTTTTCTCCTGAAG |
CCCTCGGTAAACAAAAGCCT |
80–1070 | 0.995 | 84.1 |
| ycf3-trnS-GGA_p2 | ycf3-trnS-GGA | GCCTCCTTTTCTCCTGAAGT |
CCCTCGGTAAACAAAAGCCT |
80–1069 | 0.995 | 84.1 |
| ycf3-trnS-GGA_p3 | ycf3-trnS-GGA | TGCCTCCTTTTCTCCTGAAG |
ACGGAAAGAGAGGGATTCGA |
80–1091 | 1.000 | 83.8 |
| ycf3-trnS-GGA_p4 | ycf3-trnS-GGA | GCCTCCTTTTCTCCTGAAGT |
ACGGAAAGAGAGGGATTCGA |
80–1090 | 1.000 | 83.8 |
| ycf3-trnS-GGA_p5 | ycf3-trnS-GGA | TGCCTCCTTTTCTCCTGAAG |
TTCCAATGCTACGCCTTGAA |
80–1041 | 0.995 | 83.3 |
Result downloads
Reference species (192)
One GenBank record per species. Use the NCBI button to open the Nucleotide entry for the listed accession.
| Species | Accession | Length (bp) | Link |
|---|---|---|---|
| Eremophila abietina | NC_077291.1 | 151959 | View on NCBI ↗ |
| Eremophila accrescens | NC_077446.1 | 151755 | View on NCBI ↗ |
| Eremophila acrida | NC_077355.1 | 151726 | View on NCBI ↗ |
| Eremophila adenotricha | NC_077455.1 | 151713 | View on NCBI ↗ |
| Eremophila aff. anomala RMF-2022 | NC_077410.1 | 151530 | View on NCBI ↗ |
| Eremophila aff. clarkei RMF-2022 | NC_077429.1 | 151758 | View on NCBI ↗ |
| Eremophila aff. compacta RMF-2022 | NC_077346.1 | 151595 | View on NCBI ↗ |
| Eremophila alatisepala | NC_077447.1 | 151713 | View on NCBI ↗ |
| Eremophila alternifolia | NC_077332.1 | 151620 | View on NCBI ↗ |
| Eremophila annosocaulis | NC_077456.1 | 151667 | View on NCBI ↗ |
| Eremophila anomala | NC_077424.1 | 151561 | View on NCBI ↗ |
| Eremophila appressa | NC_077412.1 | 151827 | View on NCBI ↗ |
| Eremophila arachnoides | NC_077368.1 | 151743 | View on NCBI ↗ |
| Eremophila arenaria | NC_077454.1 | 151782 | View on NCBI ↗ |
| Eremophila arguta | NC_077443.1 | 151601 | View on NCBI ↗ |
| Eremophila attenuata | NC_077441.1 | 151645 | View on NCBI ↗ |
| Eremophila aureivisca | NC_077292.1 | 151782 | View on NCBI ↗ |
| Eremophila ballythunnensis | NC_077430.1 | 147124 | View on NCBI ↗ |
| Eremophila barbata | NC_077450.1 | 151400 | View on NCBI ↗ |
| Eremophila battii | NC_077354.1 | 151752 | View on NCBI ↗ |
| Eremophila behriana | NC_077400.1 | 151675 | View on NCBI ↗ |
| Eremophila bignoniiflora | NC_077396.1 | 151504 | View on NCBI ↗ |
| Eremophila bowmanii | NC_077372.1 | 151178 | View on NCBI ↗ |
| Eremophila brevifolia | NC_077378.1 | 151534 | View on NCBI ↗ |
| Eremophila buirchellii | NC_077451.1 | 151587 | View on NCBI ↗ |
| Eremophila caerulea | NC_077448.1 | 151810 | View on NCBI ↗ |
| Eremophila calcicola | NC_077362.1 | 151553 | View on NCBI ↗ |
| Eremophila calorhabdos | NC_077436.1 | 151574 | View on NCBI ↗ |
| Eremophila campanulata | NC_077335.1 | 151553 | View on NCBI ↗ |
| Eremophila canaliculata | NC_077297.1 | 151684 | View on NCBI ↗ |
| Eremophila caperata | NC_077299.1 | 151778 | View on NCBI ↗ |
| Eremophila capricornica | NC_071842.1 | 151564 | View on NCBI ↗ |
| Eremophila christophori | NC_077437.1 | 151678 | View on NCBI ↗ |
| Eremophila ciliata | NC_077288.1 | 151773 | View on NCBI ↗ |
| Eremophila clavata | NC_077386.1 | 151765 | View on NCBI ↗ |
| Eremophila complanata | NC_077364.1 | 151640 | View on NCBI ↗ |
| Eremophila compressa | NC_077392.1 | 151737 | View on NCBI ↗ |
| Eremophila conferta | NC_077294.1 | 151533 | View on NCBI ↗ |
| Eremophila congesta | NC_077358.1 | 151668 | View on NCBI ↗ |
| Eremophila conglomerata | NC_077360.1 | 151682 | View on NCBI ↗ |
| Eremophila cordatisepala | NC_077422.1 | 151193 | View on NCBI ↗ |
| Eremophila crassifolia | NC_077276.1 | 151722 | View on NCBI ↗ |
| Eremophila cryptothrix | NC_077305.1 | 151948 | View on NCBI ↗ |
| Eremophila cuneifolia | NC_068053.1 | 151927 | View on NCBI ↗ |
| Eremophila debilis | NC_077405.1 | 148273 | View on NCBI ↗ |
| Eremophila decipiens | NC_077385.1 | 151561 | View on NCBI ↗ |
| Eremophila decussata | NC_077371.1 | 151819 | View on NCBI ↗ |
| Eremophila delisseri | NC_077369.1 | 151850 | View on NCBI ↗ |
| Eremophila dempsteri | NC_077387.1 | 151765 | View on NCBI ↗ |
| Eremophila dendritica | NC_077370.1 | 151719 | View on NCBI ↗ |
| Eremophila denticulata | NC_077281.1 | 151529 | View on NCBI ↗ |
| Eremophila deserti | NC_077391.1 | 151667 | View on NCBI ↗ |
| Eremophila dichroantha | NC_077453.1 | 151767 | View on NCBI ↗ |
| Eremophila divaricata | NC_077394.1 | 151722 | View on NCBI ↗ |
| Eremophila duttonii | NC_077345.1 | 147427 | View on NCBI ↗ |
| Eremophila elderi | NC_077381.1 | 151613 | View on NCBI ↗ |
| Eremophila enata | NC_077327.1 | 151663 | View on NCBI ↗ |
| Eremophila eriocalyx | NC_077295.1 | 151543 | View on NCBI ↗ |
| Eremophila falcata | NC_077328.1 | 151706 | View on NCBI ↗ |
| Eremophila fallax | NC_077397.1 | 151630 | View on NCBI ↗ |
| Eremophila fasciata | NC_077298.1 | 151769 | View on NCBI ↗ |
| Eremophila flabellata | NC_077324.1 | 151691 | View on NCBI ↗ |
| Eremophila flaccida | NC_077374.1 | 151823 | View on NCBI ↗ |
| Eremophila foliosissima | NC_077313.1 | 155561 | View on NCBI ↗ |
| Eremophila forrestii | NC_077442.1 | 151542 | View on NCBI ↗ |
| Eremophila forrestii subsp. forrestii | OP169585.1 | 151588 | View on NCBI ↗ |
| Eremophila fraseri | NC_077414.1 | 151872 | View on NCBI ↗ |
| Eremophila fraseri subsp. fraseri | NC_085223.1 | 151776 | View on NCBI ↗ |
| Eremophila freelingii | NC_077398.1 | 152053 | View on NCBI ↗ |
| Eremophila georgei | NC_077314.1 | 151615 | View on NCBI ↗ |
| Eremophila gibbifolia | NC_050954.1 | 148717 | View on NCBI ↗ |
| Eremophila gibbosa | NC_077389.1 | 151553 | View on NCBI ↗ |
| Eremophila gibsonii | NC_077351.1 | 147536 | View on NCBI ↗ |
| Eremophila gilesii | NC_077329.1 | 151574 | View on NCBI ↗ |
| Eremophila glabra | NC_077333.1 | 151549 | View on NCBI ↗ |
| Eremophila glandulifera | NC_077340.1 | 151583 | View on NCBI ↗ |
| Eremophila goodwinii | NC_077380.1 | 151669 | View on NCBI ↗ |
| Eremophila gracillima | NC_077440.1 | 151700 | View on NCBI ↗ |
| Eremophila granitica | NC_077342.1 | 151755 | View on NCBI ↗ |
| Eremophila hillii | NC_077293.1 | 151526 | View on NCBI ↗ |
| Eremophila hispida | NC_077423.1 | 151605 | View on NCBI ↗ |
| Eremophila homoplastica | NC_077306.1 | 151551 | View on NCBI ↗ |
| Eremophila hughesii | NC_077280.1 | 151772 | View on NCBI ↗ |
| Eremophila humilis | NC_077417.1 | 151558 | View on NCBI ↗ |
| Eremophila hygrophana | NC_077339.1 | 151805 | View on NCBI ↗ |
| Eremophila incisa | NC_077413.1 | 151511 | View on NCBI ↗ |
| Eremophila interstans | NC_077365.1 | 151827 | View on NCBI ↗ |
| Eremophila ionantha | NC_077343.1 | 151628 | View on NCBI ↗ |
| Eremophila jucunda | NC_077317.1 | 151563 | View on NCBI ↗ |
| Eremophila koobabbiensis | NC_077283.1 | 151586 | View on NCBI ↗ |
| Eremophila laanii | NC_077349.1 | 151845 | View on NCBI ↗ |
| Eremophila lachnocalyx | NC_077318.1 | 151934 | View on NCBI ↗ |
| Eremophila lactea | NC_077425.1 | 151454 | View on NCBI ↗ |
| Eremophila lanata | NC_077439.1 | 151601 | View on NCBI ↗ |
| Eremophila lanceolata | NC_068054.1 | 151565 | View on NCBI ↗ |
| Eremophila latrobei | NC_077322.1 | 151581 | View on NCBI ↗ |
| Eremophila latrobei subsp. filiformis | OL977700.1 | 151550 | View on NCBI ↗ |
| Eremophila latrobei subsp. glabra | OP169576.1 | 151574 | View on NCBI ↗ |
| Eremophila latrobei subsp. latrobei | NC_085224.1 | 151601 | View on NCBI ↗ |
| Eremophila lehmanniana | NC_077382.1 | 151543 | View on NCBI ↗ |
| Eremophila linearis | NC_077321.1 | 147415 | View on NCBI ↗ |
| Eremophila longifolia | NC_068055.1 | 151629 | View on NCBI ↗ |
| Eremophila lucida | NC_077406.1 | 147492 | View on NCBI ↗ |
| Eremophila macdonnellii | NC_077402.1 | 151325 | View on NCBI ↗ |
| Eremophila macgillivrayi | NC_077444.1 | 151753 | View on NCBI ↗ |
| Eremophila mackinlayi | NC_077373.1 | 151767 | View on NCBI ↗ |
| Eremophila macmillaniana | NC_077315.1 | 151920 | View on NCBI ↗ |
| Eremophila maculata | NC_077344.1 | 151693 | View on NCBI ↗ |
| Eremophila maculata subsp. brevifolia | OL977702.1 | 142336 | View on NCBI ↗ |
| Eremophila magnifica | NC_077309.1 | 151943 | View on NCBI ↗ |
| Eremophila magnifica subsp. magnifica | OR726994.1 | 151766 | View on NCBI ↗ |
| Eremophila magnifica subsp. velutina | OR726992.1 | 151742 | View on NCBI ↗ |
| Eremophila maitlandii | NC_077308.1 | 151531 | View on NCBI ↗ |
| Eremophila malacoides | NC_077325.1 | 151623 | View on NCBI ↗ |
| Eremophila margarethae | NC_077326.1 | 151534 | View on NCBI ↗ |
| Eremophila micrantha | NC_077457.1 | 151081 | View on NCBI ↗ |
| Eremophila microtheca | NC_077359.1 | 151488 | View on NCBI ↗ |
| Eremophila miniata | NC_077303.1 | 147535 | View on NCBI ↗ |
| Eremophila muelleriana | NC_077296.1 | 151520 | View on NCBI ↗ |
| Eremophila naaykensii | NC_084440.1 | 151683 | View on NCBI ↗ |
| Eremophila neglecta | NC_077357.1 | 147643 | View on NCBI ↗ |
| Eremophila obliquisepala | NC_077418.1 | 151668 | View on NCBI ↗ |
| Eremophila obovata | NC_077356.1 | 151499 | View on NCBI ↗ |
| Eremophila occidens | NC_077304.1 | 151707 | View on NCBI ↗ |
| Eremophila oldfieldii | NC_077338.1 | 147491 | View on NCBI ↗ |
| Eremophila oppositifolia | NC_050958.1 | 151715 | View on NCBI ↗ |
| Eremophila ovata | NC_077352.1 | 151769 | View on NCBI ↗ |
| Eremophila paisleyi | NC_077366.1 | 151761 | View on NCBI ↗ |
| Eremophila pallida | NC_077300.1 | 151687 | View on NCBI ↗ |
| Eremophila parvifolia | NC_077390.1 | 151561 | View on NCBI ↗ |
| Eremophila pentaptera | NC_077353.1 | 151687 | View on NCBI ↗ |
| Eremophila perglandulosa | NC_077307.1 | 151632 | View on NCBI ↗ |
| Eremophila petrophila | NC_077347.1 | 151790 | View on NCBI ↗ |
| Eremophila phillipsii | NC_077383.1 | 151677 | View on NCBI ↗ |
| Eremophila phyllopoda | NC_077319.1 | 151839 | View on NCBI ↗ |
| Eremophila phyllopoda subsp. obliqua | NC_085222.1 | 151756 | View on NCBI ↗ |
| Eremophila physocalyx | NC_077363.1 | 151551 | View on NCBI ↗ |
| Eremophila pilosa | NC_068056.1 | 151541 | View on NCBI ↗ |
| Eremophila platycalyx | NC_077310.1 | 151939 | View on NCBI ↗ |
| Eremophila platycalyx subsp. pardalota | OL977706.1 | 151947 | View on NCBI ↗ |
| Eremophila platythamnos | NC_077330.1 | 147559 | View on NCBI ↗ |
| Eremophila polyclada | NC_077266.1 | 151614 | View on NCBI ↗ |
| Eremophila praecox | NC_077399.1 | 151148 | View on NCBI ↗ |
| Eremophila psilocalyx | NC_077274.1 | 151692 | View on NCBI ↗ |
| Eremophila punctata | NC_077334.1 | 151601 | View on NCBI ↗ |
| Eremophila pungens | NC_077331.1 | 151677 | View on NCBI ↗ |
| Eremophila punicea | NC_077312.1 | 151561 | View on NCBI ↗ |
| Eremophila pusilliflora | NC_068057.1 | 151725 | View on NCBI ↗ |
| Eremophila pustulata | NC_077341.1 | 151720 | View on NCBI ↗ |
| Eremophila racemosa | NC_077384.1 | 151704 | View on NCBI ↗ |
| Eremophila recurva | NC_077421.1 | 151562 | View on NCBI ↗ |
| Eremophila retropila | NC_077320.1 | 151847 | View on NCBI ↗ |
| Eremophila revoluta | NC_077279.1 | 151552 | View on NCBI ↗ |
| Eremophila rhegos | NC_077420.1 | 151556 | View on NCBI ↗ |
| Eremophila rigens | NC_077361.1 | 151387 | View on NCBI ↗ |
| Eremophila rigida | NC_077302.1 | 151797 | View on NCBI ↗ |
| Eremophila rostrata | NC_077282.1 | 151562 | View on NCBI ↗ |
| Eremophila rugosa | NC_077377.1 | 151560 | View on NCBI ↗ |
| Eremophila saligna | NC_077438.1 | 151634 | View on NCBI ↗ |
| Eremophila santalina | NC_077403.1 | 151598 | View on NCBI ↗ |
| Eremophila scaberula | NC_077289.1 | 151578 | View on NCBI ↗ |
| Eremophila scoparia | NC_077388.1 | 151691 | View on NCBI ↗ |
| Eremophila serpens | NC_077427.1 | 151563 | View on NCBI ↗ |
| Eremophila serrulata | NC_077311.1 | 151588 | View on NCBI ↗ |
| Eremophila shonae | NC_077336.1 | 151685 | View on NCBI ↗ |
| Eremophila simulans | NC_077337.1 | 151661 | View on NCBI ↗ |
| Eremophila spathulata | NC_077316.1 | 151904 | View on NCBI ↗ |
| Eremophila spectabilis | NC_077411.1 | 151648 | View on NCBI ↗ |
| Eremophila splendens | NC_077375.1 | 151555 | View on NCBI ↗ |
| Eremophila spongiocarpa | NC_068058.1 | 151678 | View on NCBI ↗ |
| Eremophila spuria | NC_077323.1 | 151721 | View on NCBI ↗ |
| Eremophila stenophylla | NC_077350.1 | 151757 | View on NCBI ↗ |
| Eremophila strongylophylla | NC_077348.1 | 151764 | View on NCBI ↗ |
| Eremophila sturtii | NC_077395.1 | 147638 | View on NCBI ↗ |
| Eremophila subfloccosa | NC_077278.1 | 151553 | View on NCBI ↗ |
| Eremophila subteretifolia | NC_077284.1 | 151555 | View on NCBI ↗ |
| Eremophila succinea | NC_077393.1 | 151669 | View on NCBI ↗ |
| Eremophila tenella | NC_077376.1 | 151479 | View on NCBI ↗ |
| Eremophila ternifolia | NC_077285.1 | 151605 | View on NCBI ↗ |
| Eremophila tetraptera | NC_077379.1 | 151652 | View on NCBI ↗ |
| Eremophila tietkensii | NC_077416.1 | 152000 | View on NCBI ↗ |
| Eremophila undulata | NC_077367.1 | 151634 | View on NCBI ↗ |
| Eremophila veneta | NC_077277.1 | 151557 | View on NCBI ↗ |
| Eremophila verrucosa | NC_077428.1 | 151745 | View on NCBI ↗ |
| Eremophila verticillata | NC_077290.1 | 151603 | View on NCBI ↗ |
| Eremophila virens | NC_077286.1 | 151555 | View on NCBI ↗ |
| Eremophila viscida | NC_077287.1 | 147471 | View on NCBI ↗ |
| Eremophila viscimarginata | NC_077426.1 | 151680 | View on NCBI ↗ |
| Eremophila weldii | NC_077270.1 | 151744 | View on NCBI ↗ |
| Eremophila willsii | NC_077267.1 | 151723 | View on NCBI ↗ |
| Eremophila yinnetharrensis | NC_077419.1 | 151554 | View on NCBI ↗ |
| Eremophila youngii | NC_077415.1 | 151468 | View on NCBI ↗ |